Display Settings:

Format

Send to:

Choose Destination
Pr012527436

STS probe ECD06199 for opsin 1, long wave sensitive (OPN1LW) and 1 more gene

Synopsis

Field NameValues
NameECD06199
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesOPN1LW; OPN1MW2
UniSTS IDUniSTS:287261

Sequences

>Probe|12527436|PRIMERF Forward PCR primer (outermost) (20b)
AGTTGGGGAAAAAGCTCACC
>Probe|12527436|PRIMERR Reverse PCR primer (outermost) (20b)
CCCATGAGCTGTAGGTCCTT

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers MapX cmECD06199

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID287261
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center