Display Settings:

Format

Send to:

Choose Destination
Pr012521225

STS probe ECD00558 for stereocilin (STRC) and 10 more genes

Synopsis

Field NameValues
NameECD00558
AliasECD00607
TypeSTS
Application
Source organism
Source sequence
Target genesSTRC; LOC100434832; STRC; LOC100731299; STRC; LOC453709; STRCP1; LOC649975; LOC649989; STRC; LOC731396
UniSTS IDUniSTS:281668

Sequences

>Probe|12521225|PRIMERF Forward PCR primer (outermost) (20b)
TGGCCAAGGAAGCTGATAGT
>Probe|12521225|PRIMERR Reverse PCR primer (outermost) (20b)
AGTAACTGGGGGCCTGAGAT

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID281668
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center