Display Settings:

Format

Send to:

Choose Destination
Pr012520565

STS probe UniSTS:281072 for small nuclear ribonucleoprotein polypeptide N (SNRPN) and 3 more genes

Synopsis

Field NameValues
NameUniSTS:281072
AliasesUBE3A_1455; UBE3A_v484
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesUBE3A; SNRPN; UBE3A; LOC744573
UniSTS IDUniSTS:281072

Sequences

>Probe|12520565|PRIMERF Forward PCR primer (outermost) (21b)
TTCCAGAAGTAAGTAGTTTCC
>Probe|12520565|PRIMERR Reverse PCR primer (outermost) (21b)
GTAGGTTCATTCTGACTCTGT

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map15 cmUniSTS:281072

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID281072
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center