Display Settings:

Format

Send to:

Choose Destination
Pr012520329

STS probe UniSTS:280860 for MX dynamin like GTPase 1 (MX1) and 3 more genes

Synopsis

Field NameValues
NameUniSTS:280860
AliasMX1_1629
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesMX1; MX1; MX1; MX1
UniSTS IDUniSTS:280860

Sequences

>Probe|12520329|PRIMERF Forward PCR primer (outermost) (19b)
TTTGATCATCCAGTTCTTC
>Probe|12520329|PRIMERR Reverse PCR primer (outermost) (21b)
TGTCTGCTAGAAATGAGTTTA

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map21 cmUniSTS:280860

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID280860
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center