Display Settings:

Format

Send to:

Choose Destination
Pr012518395

STS probe D12S313 for heterogeneous nuclear ribonucleoprotein A1 pseudogene 70 (HNRNPA1P70) and 1 more gene

Synopsis

Field NameValues
NameD12S313
Aliases207XF2; AFM207xf2; HS207XF2; RH74487; stSG34807
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesHNRNPA1P70; LOC742080
UniSTS IDUniSTS:27912

Sequences

>Probe|12518395|PRIMERF Forward PCR primer (outermost) (18b)
CATCNCCAATCTCTCAGT
>Probe|12518395|PRIMERR Reverse PCR primer (outermost) (23b)
CCAAACTCATTGATGTCTTTATT

References

1.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

2.

A comprehensive genetic map of the human genome based on 5,264 microsatellites.

Dib C, Fauré S, Fizames C, Samson D, Drouot N, Vignal A, Millasseau P, Marc S, Hazan J, Seboun E, Lathrop M, Gyapay G, Morissette J, Weissenbach J.

Nature. 1996 Mar 14;380(6570):152-4.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map12 cmD12S313
Homo sapienslinkageMarshfield1279.93 cmAFM207xf2
Homo sapienslinkageGenethon1280.2 cmAFM207xf2

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID27912
Probe Cross-refcontext specific help for: Probe Cross-refGDB:199256
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center