Display Settings:

Format

Send to:

Choose Destination
Pr012516976

STS probe UniSTS:277840 for tumor protein p53 (TP53) and 3 more genes

Synopsis

Field NameValues
NameUniSTS:277840
AliasTP53_278
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesTP53; TP53; TP53; TP53
UniSTS IDUniSTS:277840

Sequences

>Probe|12516976|PRIMERF Forward PCR primer (outermost) (21b)
GTTGGTAGTTTCTACAGTTGG
>Probe|12516976|PRIMERR Reverse PCR primer (outermost) (19b)
GTTGGTTCCTGAGTTATGA

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map17 cmUniSTS:277840

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID277840
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center