Display Settings:

Format

Send to:

Choose Destination
Pr012516520

STS probe RH1484 for annexin A4 (ANXA4) and 4 more genes

Synopsis

Field NameValues
NameRH1484
AliasesA001C14; RH77719; stSG1643
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesANXA4; ANXA4; ANXA4; ANXA4; ANXA4
UniSTS IDUniSTS:27743

Sequences

>Probe|12516520|PRIMERF Forward PCR primer (outermost) (21b)
CATCAGTTGATCCTTACTAAG
>Probe|12516520|PRIMERR Reverse PCR primer (outermost) (18b)
TCAGCATTTATGTTTGGT

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map2 cmRH1484

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID27743
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center