Display Settings:

Format

Send to:

Choose Destination
Pr012516363

STS probe UniSTS:277289 for G protein subunit beta 1 (GNB1) and 5 more genes

Synopsis

Field NameValues
NameUniSTS:277289
AliasGNB1_444
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesGNB1; GNB1; GNB1; GNB1; GNB1; GNB1
UniSTS IDUniSTS:277289

Sequences

>Probe|12516363|PRIMERF Forward PCR primer (outermost) (21b)
ACCTCTTACAGTTGTAACCAT
>Probe|12516363|PRIMERR Reverse PCR primer (outermost) (21b)
TGTCAAACTGCTTTATTACAT

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map1 cmUniSTS:277289

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID277289
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center