Display Settings:

Format

Send to:

Choose Destination
Pr012516195

STS probe UniSTS:277137 for cathepsin S (CTSS) and 4 more genes

Synopsis

Field NameValues
NameUniSTS:277137
AliasCTSS_573
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesCTSS; CTSS; CTSS; CTSS; CTSS
UniSTS IDUniSTS:277137

Sequences

>Probe|12516195|PRIMERF Forward PCR primer (outermost) (21b)
GAAATATGAAGCACTTTCTCT
>Probe|12516195|PRIMERR Reverse PCR primer (outermost) (21b)
ATAGCCTAATATTTTCTTCCA

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map1 cmUniSTS:277137

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID277137
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center