Display Settings:

Format

Send to:

Choose Destination
Pr012512767

STS probe G38157 for NUMB endocytic adaptor protein (NUMB)

Synopsis

Field NameValues
NameG38157
AliasRPCI-1-240K6T7
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target geneNUMB
UniSTS IDUniSTS:27405

Sequences

>Probe|12512767|PRIMERF Forward PCR primer (outermost) (22b)
CATAAGTCATAACCCTGCATGG
>Probe|12512767|PRIMERR Reverse PCR primer (outermost) (19b)
GCAAGTTTCCTGAGGCCTC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map14 cmG38157

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID27405
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center