Display Settings:

Format

Send to:

Choose Destination
Pr012512170

STS probe PMC86038P1 for miscRNA (RDN37-2) and 9 more genes

Synopsis

Field NameValues
NamePMC86038P1
TypeSTS
Application
Source organism
Source sequence
Target genesRDN37-2; RDN25-2; ITS2-1; ITS2-2; RDN37-1; RDN58-1; RDN25-1; ITS1-1; RDN58-2; ITS1-2
UniSTS IDUniSTS:273512

Sequences

>Probe|12512170|PRIMERF Forward PCR primer (outermost) (20b)
GTCGTAACAAGGTTTCCGTA
>Probe|12512170|PRIMERR Reverse PCR primer (outermost) (25b)
ATATGCTTAAGTTCAGCGGGTAATC

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID273512
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center