Display Settings:

Format

Send to:

Choose Destination
Pr012511873

STS probe PMC351321P4 for secreted phosphoprotein 1 (SPP1) and 3 more genes

Synopsis

Field NameValues
NamePMC351321P4
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesSPP1; SPP1; SPP1; SPP1
UniSTS IDUniSTS:273245

Sequences

>Probe|12511873|PRIMERF Forward PCR primer (outermost) (20b)
ACAGCCAGGACTCCATTGAC
>Probe|12511873|PRIMERR Reverse PCR primer (outermost) (20b)
ACACTATCACCTCGGCCATC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map4 cmPMC351321P4

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID273245
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center