Display Settings:

Format

Send to:

Choose Destination
Pr012511767

STS probe PMC329392P1 for glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and 1 more gene

Synopsis

Field NameValues
NamePMC329392P1
TypeSTS
Application
Source organism
Source sequence
Target genesGAPDH; LOC772309
UniSTS IDUniSTS:273149

Sequences

>Probe|12511767|PRIMERF Forward PCR primer (outermost) (20b)
TCTTCACCACCATGGAGAAG
>Probe|12511767|PRIMERR Reverse PCR primer (outermost) (21b)
ACCAAAGTTGTCATGGATGAC

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refRGD:5035969
UniSTS IDcontext specific help for: UniSTS ID273149
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center