Display Settings:

Format

Send to:

Choose Destination
Pr012511364

STS probe PMC310880P1 for H19, imprinted maternally expressed transcript (H19) and 6 more genes

Synopsis

Field NameValues
NamePMC310880P1
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesMIR675; MIR675; LOC100452997; H19; H19; H19; Mir675
UniSTS IDUniSTS:272787

Sequences

>Probe|12511364|PRIMERF Forward PCR primer (outermost) (23b)
CACTTTTGGTTACAGGACGTGGC
>Probe|12511364|PRIMERR Reverse PCR primer (outermost) (23b)
ATACAGCGTCACCAAGTCCACTG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map11 cmPMC310880P1

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID272787
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center