Display Settings:

Format

Send to:

Choose Destination
Pr012510860

STS probe PMC263847P2 for tryptophan hydroxylase 2 (Tph2)

Synopsis

Field NameValues
NamePMC263847P2
TypeSTS
Application
Source organism
Source sequence
Target geneTph2
UniSTS IDUniSTS:272332

Sequences

>Probe|12510860|PRIMERF Forward PCR primer (outermost) (23b)
CTAGAACCAGAGTTATTGTCAGC
>Probe|12510860|PRIMERR Reverse PCR primer (outermost) (23b)
CTACAGTAGACTTGTCAGATGTC

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID272332
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center