Display Settings:

Format

Send to:

Choose Destination
Pr012510806

STS probe PMC25276P1 for vascular endothelial growth factor A (VEGFA) and 10 more genes

Synopsis

Field NameValues
NamePMC25276P1
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesVEGFA; VEGFA; VEGFA; LOC100601396; LOC100737169; VEGFA; VEGFA; VEGFA; VEGFA; VEGFA; VEGFA
UniSTS IDUniSTS:272284

Sequences

>Probe|12510806|PRIMERF Forward PCR primer (outermost) (20b)
TAGACACACCCACCCACATA
>Probe|12510806|PRIMERR Reverse PCR primer (outermost) (19b)
AACATTAGCACTGTTAATT

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map6 cmPMC25276P1

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID272284
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center