Display Settings:

Format

Send to:

Choose Destination
Pr012510735

STS probe GDB:1318344 for NudC domain containing 3 (NUDCD3) and 3 more genes

Synopsis

Field NameValues
NameGDB:1318344
AliassWSS2842
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesNUDCD3; NUDCD3; NUDCD3; NUDCD3
UniSTS IDUniSTS:27222

Sequences

>Probe|12510735|PRIMERF Forward PCR primer (outermost) (19b)
CAGTTAGTAAACATCTTGG
>Probe|12510735|PRIMERR Reverse PCR primer (outermost) (20b)
TTTAATTGGTCTGAGTGTGG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map7 cmGDB:1318344

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID27222
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center