Display Settings:

Format

Send to:

Choose Destination
Pr012510701

STS probe DXS7629 for ubiquitously expressed prefoldin like chaperone (UXT)

Synopsis

Field NameValues
NameDXS7629
AliasesHUMSWX1302; sWXD1302
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target geneUXT
UniSTS IDUniSTS:27219

Sequences

>Probe|12510701|PRIMERF Forward PCR primer (outermost) (22b)
CAGTTAGGAAATCCTGTTGTTG
>Probe|12510701|PRIMERR Reverse PCR primer (outermost) (19b)
AGGTATACGTGTGGTGTGG

References

1.

X chromosome map at 75-kb STS resolution, revealing extremes of recombination and GC content.

Nagaraja R, MacMillan S, Kere J, Jones C, Griffin S, Schmatz M, Terrell J, Shomaker M, Jermak C, Hott C, Masisi M, Mumm S, Srivastava A, Pilia G, Featherstone T, Mazzarella R, Kesterson S, McCauley B, Railey B, Burough F, Nowotny V, D'Urso M, States D, Brownstein B, Schlessinger D.

Genome Res. 1997 Mar;7(3):210-22.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers MapX cmDXS7629
Homo sapiensphysicalWUSTL-XX7.3 ordinalsWXD1302

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID27219
Probe Cross-refcontext specific help for: Probe Cross-refGDB:600163
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center