Display Settings:

Format

Send to:

Choose Destination
Pr012510578

STS probe PMC21940P1 for ryanodine receptor 2, cardiac (Ryr2) and 1 more gene

Synopsis

Field NameValues
NamePMC21940P1
TypeSTS
Application
Source organism
Source sequence
Target genesRyr2; Ryr2
UniSTS IDUniSTS:272079

Sequences

>Probe|12510578|PRIMERF Forward PCR primer (outermost) (21b)
TTCATTGCATGTTTATTATGC
>Probe|12510578|PRIMERR Reverse PCR primer (outermost) (19b)
GATGGCCTGTCAAGGCGTC

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refRGD:5504472
UniSTS IDcontext specific help for: UniSTS ID272079
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center