Display Settings:

Format

Send to:

Choose Destination
Pr012510536

STS probe PMC213490P1 for toll-like receptor 2 (Tlr2)

Synopsis

Field NameValues
NamePMC213490P1
TypeSTS
Application
Source organism
Source sequence
Target geneTlr2
UniSTS IDUniSTS:272040

Sequences

>Probe|12510536|PRIMERF Forward PCR primer (outermost) (20b)
ATACTAACTTGGCCAGGTTC
>Probe|12510536|PRIMERR Reverse PCR primer (outermost) (20b)
AAAGTGTTCCTGCTGATGTC

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID272040
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center