Display Settings:

Format

Send to:

Choose Destination
Pr012510474

STS probe PMC209322P1 for desmin (DES) and 21 more genes

Synopsis

Field NameValues
NamePMC209322P1
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesDES; LOC100288941; LOC100289976; LOC100291560; DES; DES; LOC100430577; DES; LOC100455003; DES; TMEM198; DES; Des; DesMore
UniSTS IDUniSTS:271986

Sequences

>Probe|12510474|PRIMERF Forward PCR primer (outermost) (20b)
ATGAGCCAGGCCTACTCGTC
>Probe|12510474|PRIMERR Reverse PCR primer (outermost) (20b)
GCGCACCTTCTCGATGTAGT

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map2 cmPMC209322P1

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID271986
Probe Cross-refcontext specific help for: Probe Cross-refRGD:5087498
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center