Display Settings:

Format

Send to:

Choose Destination
Pr012510449

STS probe PMC20756P3 for ATP synthase F0 subunit 6 (ATP6) and 14 more genes

Synopsis

Field NameValues
NamePMC20756P3
TypeSTS
Application
Source organism
Source sequence
Target genesLOC100288418; LOC100288578; LOC100293593; MIR320D-1; ATP6; ATP8; TRNC; COX1; COX2; TRND; TRNK; TRNN; TRNS1; TRNYMore
UniSTS IDUniSTS:271963

Sequences

>Probe|12510449|PRIMERF Forward PCR primer (outermost) (21b)
ACCTACGCCAAAATCCATTTC
>Probe|12510449|PRIMERR Reverse PCR primer (outermost) (22b)
TATGAGGGCGTGATCATGAAAG

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID271963
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center