Display Settings:

Format

Send to:

Choose Destination
Pr012510374

STS probe PMC203028P1 for gap junction protein, alpha 5 (Gja5)

Synopsis

Field NameValues
NamePMC203028P1
TypeSTS
Application
Source organism
Source sequence
Target geneGja5
UniSTS IDUniSTS:271896

Sequences

>Probe|12510374|PRIMERF Forward PCR primer (outermost) (24b)
AAGCTAAAGAGGCCCACCGCACTG
>Probe|12510374|PRIMERR Reverse PCR primer (outermost) (24b)
TTCCGGGAGCCCATGTTATTACTG

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID271896
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center