Display Settings:

Format

Send to:

Choose Destination
Pr012509899

STS probe PMC162237P1 for histone cluster 1 H2A family member g (HIST1H2AG) and 4 more genes

Synopsis

Field NameValues
NamePMC162237P1
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC462500; LOC471894; LOC735660; HIST1H2AG; HIST1H2BJ
UniSTS IDUniSTS:271467

Sequences

>Probe|12509899|PRIMERF Forward PCR primer (outermost) (20b)
CAATAGTAGTGCGTCTTCTG
>Probe|12509899|PRIMERR Reverse PCR primer (outermost) (21b)
AGCACTGTGTAGCTATAAAGC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map6 cmPMC162237P1

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID271467
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center