Display Settings:

Format

Send to:

Choose Destination
Pr012509878

STS probe PMC16008P3 for C-X-C motif chemokine ligand 8 (CXCL8) and 3 more genes

Synopsis

Field NameValues
NamePMC16008P3
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesCXCL8; CXCL8; CXCL8; CXCL8
UniSTS IDUniSTS:271448

Sequences

>Probe|12509878|PRIMERF Forward PCR primer (outermost) (22b)
CAGTTTTGCCAAGGAGTGCTAA
>Probe|12509878|PRIMERR Reverse PCR primer (outermost) (21b)
AACTTCTCCACAACCCTCTGC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map4 cmPMC16008P3

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID271448
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center