Display Settings:

Format

Send to:

Choose Destination
Pr012509837

STS probe PMC156606P3

Synopsis

Field NameValues
NamePMC156606P3
TypeSTS
Application
Source organism
Source sequence
UniSTS IDUniSTS:271410

Sequences

>Probe|12509837|PRIMERF Forward PCR primer (outermost) (20b)
TCTCGCTCTGTCGCCCAGGC
>Probe|12509837|PRIMERR Reverse PCR primer (outermost) (20b)
ATTAGCCGGGCGTAGTGGCG

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID271410
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center