Display Settings:

Format

Send to:

Choose Destination
Pr012509660

STS probe PMC153210P1 for 18S ribosomal RNA (Rn18s) and 26 more genes

Sequences

>Probe|12509660|PRIMERF Forward PCR primer (outermost) (22b)
CAAATTACCCACTCCCGACCCG
>Probe|12509660|PRIMERR Reverse PCR primer (outermost) (18b)
GCTGCTGGCACCAGACTT

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refRGD:5501193
UniSTS IDcontext specific help for: UniSTS ID271251
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center