Display Settings:

Format

Send to:

Choose Destination
Pr012509400

STS probe PMC148819P4 for myelocytomatosis oncogene (Myc) and 1 more gene

Synopsis

Field NameValues
NamePMC148819P4
TypeSTS
Application
Source organism
Source sequence
Target genesMyc; Myc
UniSTS IDUniSTS:271017

Sequences

>Probe|12509400|PRIMERF Forward PCR primer (outermost) (25b)
GGAAGAAATTGATGTGGTGTCTGTG
>Probe|12509400|PRIMERR Reverse PCR primer (outermost) (23b)
TCTTGTCGTTTTCCTCCGTGTCT

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refRGD:5501137
UniSTS IDcontext specific help for: UniSTS ID271017
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center