Display Settings:

Format

Send to:

Choose Destination
Pr012509396

STS probe PMC14826P1 for telomerase RNA component (TERC) and 4 more genes

Synopsis

Field NameValues
NamePMC14826P1
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100133738; LOC100287726; LOC100291718; LOC100593827; TERC
UniSTS IDUniSTS:271013

Sequences

>Probe|12509396|PRIMERF Forward PCR primer (outermost) (28b)
GCCTGGGAGGGGTGGTGGCCATTTTTTG
>Probe|12509396|PRIMERR Reverse PCR primer (outermost) (26b)
GTTTGCTCTAGAATGAACGGTGGAAG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map3 cmPMC14826P1

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID271013
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center