Display Settings:

Format

Send to:

Choose Destination
Pr012509210

STS probe PMC137755P1 for methylmalonic aciduria (cobalamin deficiency) cblA type (MMAA) and 4 more genes

Synopsis

Field NameValues
NamePMC137755P1
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesMMAA; MMAA; MMAA; MMAA; MMAA
UniSTS IDUniSTS:270847

Sequences

>Probe|12509210|PRIMERF Forward PCR primer (outermost) (25b)
TAGGGAGGTCACAATCACATTGAGC
>Probe|12509210|PRIMERR Reverse PCR primer (outermost) (26b)
AGACTGACCTACTCGAAATGCTAGTG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map4 cmPMC137755P1

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID270847
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center