Display Settings:

Format

Send to:

Choose Destination
Pr012508888

STS probe PMC127682P1 for chemokine (C-X-C motif) receptor 3 (Cxcr3) and 1 more gene

Synopsis

Field NameValues
NamePMC127682P1
TypeSTS
Application
Source organism
Source sequence
Target genesCxcr3; Cxcr3
UniSTS IDUniSTS:270557

Sequences

>Probe|12508888|PRIMERF Forward PCR primer (outermost) (20b)
AACGTCAAGTGCTAGATGCC
>Probe|12508888|PRIMERR Reverse PCR primer (outermost) (20b)
ATCTGGGTGGCGTGCACTAT

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refRGD:5501049
UniSTS IDcontext specific help for: UniSTS ID270557
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center