Display Settings:

Format

Send to:

Choose Destination
Pr012508863

STS probe PMC126239P2 for succinate dehydrogenase complex flavoprotein subunit A (SDHA) and 1 more gene

Synopsis

Field NameValues
NamePMC126239P2
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesSDHA; SDHA
UniSTS IDUniSTS:270534

Sequences

>Probe|12508863|PRIMERF Forward PCR primer (outermost) (20b)
TGGGAACAAGAGGGCATCTG
>Probe|12508863|PRIMERR Reverse PCR primer (outermost) (22b)
CCACCACTGCATCAAATTCATG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map5 cmPMC126239P2

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID270534
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center