Display Settings:

Format

Send to:

Choose Destination
Pr012508811

STS probe PMC125271P2 for heat shock protein family A (Hsp70) member 1A (HSPA1A) and 3 more genes

Synopsis

Field NameValues
NamePMC125271P2
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesHSPA1A; HSPA1L; HSPA1A; HSPA1L
UniSTS IDUniSTS:270488

Sequences

>Probe|12508811|PRIMERF Forward PCR primer (outermost) (25b)
CCTCCAGTGAATCCCAGAAGACTCT
>Probe|12508811|PRIMERR Reverse PCR primer (outermost) (22b)
TGGGACAACGGGAGTCACTCTC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map6 cmPMC125271P2

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID270488
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center