Display Settings:

Format

Send to:

Choose Destination
Pr012508741

STS probe UniSTS:270424 for insulin (INS) and 7 more genes

Synopsis

Field NameValues
NameUniSTS:270424
AliasPMC123023P3
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesINS; Ins; Ins2; Ins1; Ins2; INS; INS; INS-IGF2
UniSTS IDUniSTS:270424

Sequences

>Probe|12508741|PRIMERF Forward PCR primer (outermost) (20b)
ATGGCCCTGTGGATGCGCTT
>Probe|12508741|PRIMERR Reverse PCR primer (outermost) (22b)
TAGTTGCAGTAGTTCTCCAGCT

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map11 cmUniSTS:270424

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID270424
Probe Cross-refcontext specific help for: Probe Cross-refRGD:5501019
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center