Display Settings:

Format

Send to:

Choose Destination
Pr012508720

STS probe PMC122623P1 for actin, beta (Actb) and 10 more genes

Synopsis

Field NameValues
NamePMC122623P1
TypeSTS
Application
Source organism
Source sequence
Target genesGm3903; Gm15725; Actb; LOC100584240; ACTB; Actb; Actb; Lrrc58; LOC502977; 1810012N18Rik; Actb
UniSTS IDUniSTS:270405

Sequences

>Probe|12508720|PRIMERF Forward PCR primer (outermost) (27b)
CTCCTCCTGAGCGCAAGTACTCTGTGT
>Probe|12508720|PRIMERR Reverse PCR primer (outermost) (26b)
GTGCACGATGGAGGGGCCGGACTCAT

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refRGD:5066228
UniSTS IDcontext specific help for: UniSTS ID270405
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center