Display Settings:

Format

Send to:

Choose Destination
Pr012508641

STS probe PMC117401P1 for heat shock protein family A (Hsp70) member 1A (HSPA1A) and 29 more genes

Sequences

>Probe|12508641|PRIMERF Forward PCR primer (outermost) (24b)
CGGAGGAGATCTCGTCCATGGTGC
>Probe|12508641|PRIMERR Reverse PCR primer (outermost) (24b)
ACGACAGCGTCCTCTTGGCCCTCT

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refRGD:5031258
UniSTS IDcontext specific help for: UniSTS ID270334
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center