Display Settings:

Format

Send to:

Choose Destination
Pr012508537

STS probe PMC112649P2 for Harvey rat sarcoma virus oncogene (Hras) and 3 more genes

Synopsis

Field NameValues
NamePMC112649P2
TypeSTS
Application
Source organism
Source sequence
Target genesHras; Hras; Hras; Lrrc56
UniSTS IDUniSTS:270240

Sequences

>Probe|12508537|PRIMERF Forward PCR primer (outermost) (22b)
CTCCTACCGGAAACAGGTGGTC
>Probe|12508537|PRIMERR Reverse PCR primer (outermost) (21b)
GCTAGCCATAGGTGGCTCACC

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refRGD:5500989
UniSTS IDcontext specific help for: UniSTS ID270240
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center