Display Settings:

Format

Send to:

Choose Destination
Pr012508505

STS probe PMC111029P5 for checkpoint kinase 2 (CHEK2) and 2 more genes

Synopsis

Field NameValues
NamePMC111029P5
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesCHEK2; CHEK2; CHEK2
UniSTS IDUniSTS:270211

Sequences

>Probe|12508505|PRIMERF Forward PCR primer (outermost) (22b)
GAAATGAGAAACCACCAATCAC
>Probe|12508505|PRIMERR Reverse PCR primer (outermost) (19b)
TCAGTGATCGCCTCTTGTG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map22 cmPMC111029P5

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID270211
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center