Display Settings:

Format

Send to:

Choose Destination
Pr012508410

STS probe PMC107853P1 for similar to Hypoxanthine-guanine phosphoribosyltransferase (HGPRT) (HGPRTase) (LOC680598) and 1 more gene

Synopsis

Field NameValues
NamePMC107853P1
AliasPMC98581P1
TypeSTS
Application
Source organism
Source sequence
Target genesLOC100911712; LOC680598
UniSTS IDUniSTS:270126

Sequences

>Probe|12508410|PRIMERF Forward PCR primer (outermost) (20b)
GACAGGACTGAAAGACTTGC
>Probe|12508410|PRIMERR Reverse PCR primer (outermost) (20b)
GTTGAGAGATCATCTCCACC

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refRGD:5031230
UniSTS IDcontext specific help for: UniSTS ID270126
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center