Display Settings:

Format

Send to:

Choose Destination
Pr012508240

STS probe SHGC-13302 for toll like receptor 4 (TLR4)

Synopsis

Field NameValues
NameSHGC-13302
AliasRH29486
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target geneTLR4
UniSTS IDUniSTS:26997

Sequences

>Probe|12508240|PRIMERF Forward PCR primer (outermost) (18b)
CAGTCATGGCACAGCGTC
>Probe|12508240|PRIMERR Reverse PCR primer (outermost) (20b)
CTCTGCTTCACATTTTGCCA

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G394091 cr10000SHGC-13302
Homo sapienslinkageRutgers Map9 cmSHGC-13302
Homo sapiensradiation hybridNCBI RH91079.5 crSHGC-13302

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID26997
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center