Display Settings:

Format

Send to:

Choose Destination
Pr012507564

STS probe MARC_4339-4340:996679552:1 for nuclear receptor subfamily 1 group I member 2 (NR1I2) and 23 more genes

Synopsis

Field NameValues
NameMARC_4339-4340:996679552:1
TypeSTS
Application
Source organism
Source sequence
Target genesCWF19L1; PHBP9; LOC100293098; PHBP8; NR1I2; LOC100449186; CWF19L1; NR1I2; LOC100751168; LOC100765984; CWF19L1; LOC484431; B4GALNT2; CWF19L1More
UniSTS IDUniSTS:269360

Sequences

>Probe|12507564|PRIMERF Forward PCR primer (outermost) (23b)
TCCATCACTACAGAGATCCTCAA
>Probe|12507564|PRIMERR Reverse PCR primer (outermost) (20b)
CGCTTCTGTGAACTCCTTCC

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID269360
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center