Display Settings:

Format

Send to:

Choose Destination
Pr012506058

STS probe UniSTS:268004 for cartilage intermediate layer protein 2 (CILP2) and 8 more genes

Synopsis

Field NameValues
NameUniSTS:268004
AliasMARC_16334-16335:1017683498:1
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesCILP2; CILP2; CILP2; CILP2; LOC100622505; Cilp2; CILP2; CILP2; CILP2
UniSTS IDUniSTS:268004

Sequences

>Probe|12506058|PRIMERF Forward PCR primer (outermost) (20b)
GTACAACGTGGTCCCCTTCC
>Probe|12506058|PRIMERR Reverse PCR primer (outermost) (20b)
CCATAGTTGTGACCCAGAGG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map19 cmUniSTS:268004

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID268004
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center