Display Settings:

Format

Send to:

Choose Destination
Pr012505957

STS probe UniSTS:267914 for collagen type II alpha 1 chain (COL2A1) and 11 more genes

Synopsis

Field NameValues
NameUniSTS:267914
AliasMARC_15881-15882:1015249633:1
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesCOL2A1; COL2A1; COL2A1; LOC100621630; COL2A1; Col2a1; Col2a1; COL2A1; COL2A1; COL2A1; COL2A1; COL2A1
UniSTS IDUniSTS:267914

Sequences

>Probe|12505957|PRIMERF Forward PCR primer (outermost) (20b)
CCAGCCTTCTCATCAAATCC
>Probe|12505957|PRIMERR Reverse PCR primer (outermost) (19b)
TCGTGGCAGAGATGGAGAG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map12 cmUniSTS:267914

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID267914
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center