Display Settings:

Format

Send to:

Choose Destination
Pr012505505

STS probe MARC_13500-13501:1002732289:3 for minichromosome maintenance complex component 3 (MCM3) and 3 more genes

Synopsis

Field NameValues
NameMARC_13500-13501:1002732289:3
TypeSTS
Application
Source organism
Source sequence
Target genesMCM3; MCM3; MCM3; MCM3
UniSTS IDUniSTS:267506

Sequences

>Probe|12505505|PRIMERF Forward PCR primer (outermost) (21b)
GCAGGACACCCAGATTTATGA
>Probe|12505505|PRIMERR Reverse PCR primer (outermost) (20b)
GCTTGATAATTTTGGCCACG

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID267506
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center