Display Settings:

Format

Send to:

Choose Destination
Pr012504434

STS probe UniSTS:266542 for recombination activating 2 (RAG2) and 26 more genes

Synopsis

Field NameValues
NameUniSTS:266542
AliasRAG2
TypeSTS
Application
Source organism
Source sequence
Target organismsHomo sapiens; Felis catus
Target genesRAG2; C12H11orf74; RAG2; RAG2; LOC100336269; RAG2; RAG2; C11H11orf74; CUNH11orf74; RAG2; rag2; RAG2; C15H11orf74; Rag2More
UniSTS IDUniSTS:266542

Sequences

>Probe|12504434|PRIMERF Forward PCR primer (outermost) (21b)
TCATGGAGGGAAAACACCAAA
>Probe|12504434|PRIMERR Reverse PCR primer (outermost) (20b)
TGCACTGGAGACAGAGATTC

References

1.

A high-resolution cat radiation hybrid and integrated FISH mapping resource for phylogenomic studies across Felidae.

Davis BW, Raudsepp T, Pearks Wilkerson AJ, Agarwala R, Schäffer AA, Houck M, Chowdhary BP, Murphy WJ.

Genomics. 2009 Apr;93(4):299-304. doi: 10.1016/j.ygeno.2008.09.010. Epub 2008 Nov 5.

2.

Radiation hybrid mapping of 304 novel microsatellites in the domestic cat genome.

Menotti-Raymond M, David VA, Agarwala R, Schäffer AA, Stephens R, O'Brien SJ, Murphy WJ.

Cytogenet Genome Res. 2003;102(1-4):272-6.

Show All 3 References...

3.

Second-generation integrated genetic linkage/radiation hybrid maps of the domestic cat (Felis catus).

Menotti-Raymond M, David VA, Roelke ME, Chen ZQ, Menotti KA, Sun S, Schäffer AA, Tomlin JF, Agarwala R, O'Brien SJ, Murphy WJ.

J Hered. 2003 Jan-Feb;94(1):95-106. J Hered. 2003 Nov-Dec;94(6):following table of contents.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map11 cmUniSTS:266542
Felis catusradiation hybridRHD1946.1..967.5 crRAG2

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID266542
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center