Display Settings:

Format

Send to:

Choose Destination
Pr012503892

STS probe UniSTS:266054 for solute carrier family 25 member 4 (SLC25A4) and 9 more genes

Synopsis

Field NameValues
NameUniSTS:266054
AliasSLC25A4
TypeSTS
Application
Source organism
Source sequence
Target organismsHomo sapiens; Felis catus
Target genesLOC100339730; LOC100359427; SLC25A4; SLC25A4; SLC25A4; SLC25A4; SLC25A4; SLC25A4; SLC25A4; Slc25a4
UniSTS IDUniSTS:266054

Sequences

>Probe|12503892|PRIMERF Forward PCR primer (outermost) (20b)
TCTTCAAGTCTGATGGCCTG
>Probe|12503892|PRIMERR Reverse PCR primer (outermost) (20b)
TCACACTCTGGGCAATCATC

References

1.

A high-resolution cat radiation hybrid and integrated FISH mapping resource for phylogenomic studies across Felidae.

Davis BW, Raudsepp T, Pearks Wilkerson AJ, Agarwala R, Schäffer AA, Houck M, Chowdhary BP, Murphy WJ.

Genomics. 2009 Apr;93(4):299-304. doi: 10.1016/j.ygeno.2008.09.010.

2.

Radiation hybrid mapping of 304 novel microsatellites in the domestic cat genome.

Menotti-Raymond M, David VA, Agarwala R, Schäffer AA, Stephens R, O'Brien SJ, Murphy WJ.

Cytogenet Genome Res. 2003;102(1-4):272-6.

Show All 3 References...

3.

Second-generation integrated genetic linkage/radiation hybrid maps of the domestic cat (Felis catus).

Menotti-Raymond M, David VA, Roelke ME, Chen ZQ, Menotti KA, Sun S, Schäffer AA, Tomlin JF, Agarwala R, O'Brien SJ, Murphy WJ.

J Hered. 2003 Jan-Feb;94(1):95-106. J Hered. 2003 Nov-Dec;94(6):following table of contents.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map4 cmUniSTS:266054
Felis catusradiation hybridRHB1129.9 crSLC25A4

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID266054
Probe Cross-refcontext specific help for: Probe Cross-refRGD:7193127
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center