Display Settings:

Format

Send to:

Choose Destination
Pr012503270

STS probe PMC24644P6 for insulin (INS) and 13 more genes

Synopsis

Field NameValues
NamePMC24644P6
AliasesIns1; Ins2
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesINS; INS; INS; INS; Ins; Ins1; Ins2; Ins1; Ins2; INS; INS; INS; INS; INS-IGF2
UniSTS IDUniSTS:265494

Sequences

>Probe|12503270|PRIMERF Forward PCR primer (outermost) (19b)
GGCTTCTTCTACACACCCA
>Probe|12503270|PRIMERR Reverse PCR primer (outermost) (20b)
CAGTAGTTCTCCAGCTGGTA

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map11 cmPMC24644P6

Computational maps for probe

Analysis is pending.

Additional Data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center