Display Settings:

Format

Send to:

Choose Destination
Pr012503236

STS probe Nefh for neurofilament, heavy polypeptide (Nefh)

Synopsis

Field NameValues
NameNefh
TypeSTS
Application
Source organism
Source sequence
Target geneNefh
UniSTS IDUniSTS:265463

Sequences

>Probe|12503236|PRIMERF Forward PCR primer (outermost) (20b)
AGCCTGAGGAGAAGCCCAAA
>Probe|12503236|PRIMERR Reverse PCR primer (outermost) (20b)
CGTAGCGTTCAGCATACATC

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refMGI:2681701
UniSTS IDcontext specific help for: UniSTS ID265463
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center