Display Settings:

Format

Send to:

Choose Destination
Pr012501741

STS probe UniSTS:264117 for myosin heavy chain 7 (MYH7) and 13 more genes

Synopsis

Field NameValues
NameUniSTS:264117
AliasesMYH7; L10129
TypeSTS
Application
Source organism
Source sequence
Target organismsHomo sapiens; Canis lupus familiaris
Target genesMYH6; LOC100335644; MYH8; MYH7; MYH7; MYH7; LOC100470185; LOC100601359; LOC100626605; MYH7; MYH7; MYH7; MYH6; LOC745215
UniSTS IDUniSTS:264117

Sequences

>Probe|12501741|PRIMERF Forward PCR primer (outermost) (22b)
GGTGCTCTACAACCTCAAGGAG
>Probe|12501741|PRIMERR Reverse PCR primer (outermost) (19b)
GATGGAGAAGATGTGGGGC

References

1.

A 1-Mb resolution radiation hybrid map of the canine genome.

Guyon R, Lorentzen TD, Hitte C, Kim L, Cadieu E, Parker HG, Quignon P, Lowe JK, Renier C, Gelfenbeyn B, Vignaux F, DeFrance HB, Gloux S, Mahairas GG, André C, Galibert F, Ostrander EA.

Proc Natl Acad Sci U S A. 2003 Apr 29;100(9):5296-301. Epub 2003 Apr 16.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map14 cmUniSTS:264117
Canis lupus familiarisradiation hybridRHDF50008575 tsp unitsMYH7

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID264117
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center