Display Settings:

Format

Send to:

Choose Destination
Pr012500993

STS probe UniSTS:263444 for karyopherin subunit alpha 3 (KPNA3) and 7 more genes

Synopsis

Field NameValues
NameUniSTS:263444
AliasesEST9H12; AJ537241
TypeSTS
Application
Source organism
Source sequence
Target organismsHomo sapiens; Canis lupus familiaris
Target genesKPNA3; LOC100430074; KPNA3; KPNA3; KPNA3; KPNA3; KPNA3; KPNA3
UniSTS IDUniSTS:263444

Sequences

>Probe|12500993|PRIMERF Forward PCR primer (outermost) (25b)
ATTTGACATAAACCTGATTTGCAGT
>Probe|12500993|PRIMERR Reverse PCR primer (outermost) (25b)
TTGGGAAATTATACCCAGTAAACAA

References

1.

A 1-Mb resolution radiation hybrid map of the canine genome.

Guyon R, Lorentzen TD, Hitte C, Kim L, Cadieu E, Parker HG, Quignon P, Lowe JK, Renier C, Gelfenbeyn B, Vignaux F, DeFrance HB, Gloux S, Mahairas GG, André C, Galibert F, Ostrander EA.

Proc Natl Acad Sci U S A. 2003 Apr 29;100(9):5296-301. Epub 2003 Apr 16.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map13 cmUniSTS:263444
Canis lupus familiarisradiation hybridRHDF500022400 tsp unitsEST9H12

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID263444
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center